Detailed Information [105296]

Strain Information
DGRC Number 105296
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG13894[NP6625] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG13894NP6625 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 61C8
Map Viewer
Related Genes CG13894 CG13895 CG3279
Original Number 6625
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6625

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1731
General Information NP_lines
Embryonic Expression head (anterior of cf in stg 8, anterior of md in stg 11). ol, CNS
Larval GFP cns
Larval X-gal boundary between wing and notum, CNS, sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01435_0711
Strand Minus
Insertion Point 679738
Chromosome Band 3L
Flanking Sequence
gaagttttggnngganangtgtgcnagccacttttggtactncggaaagcttcggctatc
gacgggaccccttatgttatttcatcatgGTCGAGTCGTGGCTGTTGGCTGTTGGCTGTA
GCTGTAGCTGTAGCGATGATGATGTCGCTAGTTTCTGTTTCGAACACTCTGTGTTGAACG
TTCGTTGGCGGCGGTTCACGCATCGCGTCCGCAGATTTTGCGCCGAGTTCCCGAGTGGTT
CGAAATACCATAGATACTATACCATAGAGACCTGGATTTATAGACTCTGATTTGTGGATA
TATCTGAACGCATTTGCGTTACTCGGAAACACTGGATGTGAGTGGAGTCCACTGTGCGGA
TGAGTGATATTCATGATTTAAGTAACTGCGATGTGTGTTTGGGTGGTGTAAACAAACGGG
GTCTTGAGATTCAGTCGCGTCGCTGCCAACGCCTCTTTGTTATTGTTTTGGTGTGTTTGC
AATTAAAAAAAAAAGCCGCATTTGCATGTGCGTTTGAGTTTGTTGTTGGGTGCCCNCCTT
TGAAAAAAAACCCCCTTTTGTTTTTATTNGAGTTCCTTANACCGCNCGGNGGTCAAGGGG
GTTTGGTTTTGGATTTTGGTTTTGGCATTTGCCCTCTTTTGTTTTCNCTGCTTTTTNGGG
GGGGGGNGGGAANAAAAGAACATTGCCCCGCTTGATTTGGGCNCCCAATNGNANAAAAAC
GTGCCTTTTTGGGAAAAAAANNGAGTNCTTTGAAATNNGGCCAAAGGANNNATTTGGGCA
TTCGGAGGGGGGCNTTNCNNtttgncccggaaagngggngcctctttggctttaaaaggg
ggnctngattaataaanaaaaggtngtttntttnnananctttttttattggaattacca
annngccnggnggnataaaaaagggnctttatttggaanaaaggggggcntttgaaanga
nanggncctttgcttaatnntaaanattttaagattttaaan

Image Files
Disc

d1 (->Large)

d2 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)


CLOSE