Detailed Information [105328]

Strain Information
DGRC Number 105328
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Alh[NP7010] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}AlhNP7010 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 84C1
Map Viewer
Related Genes Mlp84B Alhambra CG14612
Original Number 7010
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7010

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1365
General Information NP_lines
Lethality semi lethal
Embryonic Expression tracheal associated cells with occational protrusion. some of them are clearly part of trachea. strong in cns, and brain. not/weak in pns. No PNS signal (TU)
Larval GFP sg
Larval X-gal ch organ, sg, CNS, epi
Adult GFP weak internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33065_0907
Flanking Sequence
ttttngcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgATCNNATTAANACATANGANANAANNGGCNCNANAGCAAC
CCATTATTGTTGNGNTGCGCATNCANGNANGACNANCANTCCCACNTGNAATTCTGTTGA
TACCGCCNAATCCATGAATAGNATCNNNGGCTNTAAAATCCAANGNAATTGNNGNGTCNN
CANGNCNAGCTGATCTGAGNGAGACGATTCATTCACCTGCNAGTTGANACTGTTNGGACT
ACTCTCTAGCCNATGATGATGCANNTACTNATTCTNTGNTGACNGAGTGTNANNNNCATA
TCACGANTGCACNGAAGCCANCTTTTTCNGNGCTCCNTNCTTTGNGAGNCTGNCTTTNTG
GCTGGGTCGCATTCGATNNTAGCCGGNGNCATAGCCGNTGNTTGCCTACCTATGTTNTNN
GTNANAAGAAGGTGGNNTGNAATTTAACNCGNAAGCGCTCCCGTNATTATTGGTTGAGCG
CCGNGGNGTAAGTAGNAAAAGNCCCAGGTGCTGGNGGAACTCGATGCAGGNCGGGNAAAC
CAACGCGATAATTGNNANAAGAGAGGGCGCTAAAGGAGAGGNGGGTAANCAACAAANGGA
ATAGTTTTTGGAGAGGNACAACACCAAGCAATANTTNTNTTGGGGCGCATGGANATAATN
GGGCTTAATGGAAACATATCAGACAANGCGTAAGGTTGGATTTGCCAAATATGNTGATAC
CAGGAGNTGGNNTTGGCGGGnttcaaaagggggtttnaaccnggactcaangtttngggt
ttggggnttttaaaatttaaaatgggnacnnnngngnnntccccaaatanangnaagctt
tttgng

Library Name / Clone Name np / np62953_0309
Strand Minus
Insertion Point 2929985
Chromosome Band 3R
Flanking Sequence
cttttactncgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgAACAGGATAATCACGATTGCGGCAGCTGGCTAGCAGGAG
AATCACAAAAAAAAGCCGAGGGTTAGAAAACAATTCGAAAAGCTTGGGATGAGTACAGAA
CTTGACCATGAAAAAGGATTAACTCGATTCTCAATTACAAAACATTTCGCATTTAAAACT
TTGGCTTACAGTAGAACTTAACAAACTTTTAAACTGTATTGAAATACTGTGTGCCCATTT
TCATAAACACCTTTTGATTGTAACTCGATGTTTGGCCGGTTCTTCCTTTTCTTGACCTGA
ATCTAATGAGGCATGAAGGTGTTTTTGTCGGTTTTGGAAATTTGAAACCGGAGTTTTTGA
GAGCAACAGGCATGCGCCGCCACCTCGTTGTTGAGAGATNCTNTAGCTNNCGCNTTGGCC
ACTNANGGATNTGGATCCTNTANCTAGANNNNTNNNNNNNNNNNNNNNNTNNNNNNNNNN
NNNNNNNNNNNNCCNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE