Detailed Information [105339]

Strain Information
DGRC Number 105339
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Acer[NP7030] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}AcerNP7030 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 29D4
Map Viewer
Related Genes Acer CG13091 lmg
Original Number 7030
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7030

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1117
General Information NP_lines
Embryonic Expression weak
Larval GFP fb, epi
Larval X-gal sg, fb, stripes in epi,
Adult GFP strong internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33725_0907
Strand Plus
Insertion Point 8515065
Chromosome Band 2L
Flanking Sequence
CTTTTTGGCGNGCACTCAATTTTGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACC
CCTTACCCCACTCCNATGCGGCAGAACTTCGCCGAGTNTGTGCGACTGACGCGCAAGGCA
TNTCANTTGAATGGTAAGTGATGGACGCCTAGATAACCCNATGTCTGACCCAAATCGGGA
GAAATCGGTTNGGCCAGCACAGGGAGAAATAGCTTATCCACTTGACATTTATCTGNGGTG
AAGTACTTGGGTATTTATACCTAATTTCGGTGCACTNTACAATATCGNGATATAAGGAAG
TTAGGGTGATCGAAAAATACNTAAGAGAGAACCGCCTGCAAAGAACCCATTATNGNTGGG
GTCCGTTTTCAGGAAGGGCAAGCCATTCAACCATGTCATTCTTTTGAGACCAAATAAATT
CNTGGAGAGCNTNCCTGGGCATTAAATTCAACNGAATTGTGGNGTTATCATGATGAGCTG
GCCGGTCAATCGATTCAGGCAACTGGGTTTGACCCTTGGTACTNCTNTTTTTCCAANNAG
ANGGNGCNCTTTTTTCTATGCTGGCTNAATGGTAGANGCATNTNANGCTNCACTGGAGCC
ATNTTTTTTGGGGNNNNNNNNNNNNNNNNNNNNNGGNNNNNNTTNTNNNNNNNNNNNNNN
NNNTTNNNNNNNNNNNNNNNNNCCCNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn


CLOSE