Detailed Information [105362]

Strain Information
DGRC Number 105362
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7088 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7088 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 49D6; -; 49D7
Map Viewer
Related Genes Nmda1 Aats-asp
Original Number 7088
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7088

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 717
General Information NP_lines
Lethality lethal
Embryonic Expression weak
Larval GFP midgut
Larval X-gal wing margin and pouch, mg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A.
Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster.
J Comp Neurol. (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33895_0907
Strand Plus
Insertion Point 7945003
Chromosome Band 2R
Flanking Sequence
annctttnggggaaaaaacccnttttttggtatacttcggtaagccttcggctatcgacg
ggaccaccttatgttatttcatcatgCTCTAGACTGCACCGCGCTGGTGGCATGTGCAAT
AGTACACGACGCTCGTGAAATCAATTCGTTTGTGTATTAAAAGGGCAAgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttgnnttncgttttcaggaagggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagtctccactgaagccatcttnntnttggnnnnnnnn
tnnnnnnnganganngnngnnnnnnnttanttnnntggntnnannnnntnggnnggnang
nnnannnnnnncannnnaatganacccnnatnnnnnnnntnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE