| Strain Information | |
|---|---|
| DGRC Number | 109537 |
| Genotype with FlyBase Link | w[1118]; P{w[+mC]=Gr5a}f16f |
| Genotype | w1118; P{w+mC=Gr5a}f16f |
| Break points/Insertion Site | 5A12-13, X ?? |
| Related Genes | Tre, Gr5a |
| Received Date | 13 July 2012 |
| Additional Original Info | Gr5a, Gustatory receptor 5a, Tre, Trehalose sensitivity, trehalose receptor |
| Also known as | w[1118]; p{Gr5a}f16f |
| Original Source | Masa-Toshi Yamamoto |
| Original Comments | Construct: p{Gr5a}=Gr5a genome in pCaSpeR4 Marker: w[+] Nucleotide position of the insertion in AE003435: 52881/52888. Orientation: R (U = universe, R = reverse) 5' sequence obtained by inverse PCR: GGCTACAGTTTTTTAGTCCGAGCGC 3' sequence obtained by inverse PCR: CTGTAGCCCAGCCGCTCATTTCGTTTGTTGTTCTTGTTGCCGCTGTTGTTAATTGACGACAGTGAAAATACGACACTTTGCGC rescued for Tre by this constract. |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Isono K, Morita H, Kohatsu S, Ueno K, Matsubayashi H, Yamamoto MT. Trehalose sensitivity of the gustatory receptor neurons expressing wild-type, mutant and ectopic Gr5a in Drosophila. Chem Senses (2005) 30 Suppl 1 i275-6 [RRC reference] |
| Last update | 2022-02-01 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |