| Strain Information | |
|---|---|
| DGRC Number | 109544 |
| Genotype with FlyBase Link | w[1118]; P{w[+mC]=CG3171}f5m |
| Genotype | w1118; P{w+mC=CG3171}f5m |
| Break points/Insertion Site | 88C10-D2, 3R |
| Related Genes | Tre1 |
| Received Date | 13 July 2012 |
| Additional Original Info | CG3171, Tre-1, Trapped in endoderm-1 |
| Also known as | w[1118]; p{CG3171}f5m |
| Original Source | Masa-Toshi Yamamoto |
| Original Comments | Construct: p{CG3171}=CG3171 genome in pCaSpeR4 Marker: w[+] Nucleotide position of the insertion in AE003705: 216601. Orientation: R (U = universe, R = reverse) 5' sequence obtained by inverse PCR: GTGTGGCTATACGTGTTTTCAGTGTGACCAGACGTATCGTTATGCGAAATGCCAAAAATACATCGGTTACAAGATTGGTGTGTCCGCTAAGTAAGGTTTTTGTCTTTGCTAATTCAAACAATCGATAACTTCCGATACCACTAGCA not rescued for Tre by this constract. |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Isono K, Morita H, Kohatsu S, Ueno K, Matsubayashi H, Yamamoto MT. Trehalose sensitivity of the gustatory receptor neurons expressing wild-type, mutant and ectopic Gr5a in Drosophila. Chem Senses (2005) 30 Suppl 1 i275-6 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |