Detailed Information [109688]

Strain Information
DGRC Number 109688
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}cpo[KM0230] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}cpoKM0230 / TM6C, Sb1
Break points/Insertion Site 99D1
Related Genes cpo
Received Date 22 November 2012
Original Number 230
Chromosome 3R
Comments Expression Photo: KM0230

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:13776820 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 99D1
Inserted gene: cpo
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation, premature stop
General Information Kyoto_piggyTrap
Lethality lethal
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:13776820
Chromosome Band 99D1
Flanking Sequence
TCGCCCTTGCTCACCATTTTGATTATCTGTAAGGAAGAAAAAATTAGCTGCAGATAAATA
AACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAAC
GTACGTCGCAATATGATTATCTTTCTAGGGTTAAAAGTCACTGTATTTATATAATATATA
CACATATTCATTCATAATCCATGATTATAAGGGAAATTATATTTATACTTGGCAAAAACT
TTTCTCAATCAAAAGCTTGCTAAAATGTCAGCGCTCCTGGACGTAGCCTTCGGGCATGGC
GGACTTGAAAAGGTCGTGCTAAACCTGCGCTTGGGGATCAGCTTCCGCCCCGAGTTGCGC
CCTTTGCGGGTGTTTGCCTTACTAAAGTGGCGATACCGGAACCTTTTTCGCGATTGGACG
ACTTAGACGACTCTGGCTACCCTGACTAAGAAGTGATAATAAATTCATAAAAGAACCCAT
GCTGCAAACAGACCCAATCACGGCTGACTCGAAGCTGGCAACCTACGGCGGGGATTACCC
AGAAGAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE