Detailed Information [109690]

Strain Information
DGRC Number 109690
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Adk1[KM0006]
Genotype w1118; PBac{EGFP-IV}Adk1KM0006
Break points/Insertion Site 69A2
Related Genes Adk1
Received Date 22 November 2012
Original Number 6
Chromosome 3L
Comments Expression Photo: KM0006

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:12196121 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 69A2
Inserted gene: Adk1
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:12196121
Chromosome Band 69A2
Flanking Sequence
CGTTCACTTTTGATTATCTGTAGGAGAAAAATTAGCTGCAGATAAATAAACCTCGATATA
CAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGCAAT
ATGATTATCTTTCTAGGGTTAATAATGCGACGCGACCAAGACTAAAAACCGGCATGACTG
TCTAGTTCGAGTAGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGT
GCTGCTTCATGTGTCGGGGTAGCGACCCATTCTGTCTGACCTTGTCAGCGTCTAATCGGC
CACAAGTTCGGCTTGTCCAGCGCGGGCGAAGCCTATGCCACCTACTGAAATATGAAACTC
CCACGTGGGGCATTATTACGGTCCAGGGCGCGGAAACTGAGGTGGTGCCTACAGATGTCG
GCGCCAAACTAAACGCCGTTGGGAGTCATGGTGGAGGCACTCTACCGCCAAACACATCAT
ATTTGGAATACATTAAAAAGATCGTGCGAGATCGACGCGCGTCTCTCATGGGCGTAGCTG
AGGGAATGACGAGCTCTAATATGTTCTTCTTATGATGTGCAAAGGGTCACACGGTAAGGA
CTGTACACATAATTGATGCCAGCGGATCAACTGGACTCCTCATAGAATCTGCAATCCTCG
TCCACTGCAGGTGAGTAAAAGCGTACGCAGTTACTTAAAGAGATGGCAGCTCTTATACAA
TCTAACGTGAATATTATAGAGATCGTGTGTGACTTTAAAAGAAGATAATATGGTGTACTT
GACGCAAAAAGAAAATCCAGTCTCTAGACAAGCCGCCCCCAATGGACTGCTCTCCGTTCA
GTGCGAATCTATCACTCGATGTCCTGGTGACAGGTTCACGTACACATCGCATATGTCCAA
CTTCACACTCTCTGCAGACACTG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE