Detailed Information [109691]

Strain Information
DGRC Number 109691
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}A2bp1[KM0092] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}A2bp1KM0092 / TM6C, Sb1
Break points/Insertion Site 67E4
Related Genes A2bp1
Received Date 22 November 2012
Original Number 92
Chromosome 3L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:10510198? (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 67E4
Inserted gene: A2bp1
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame(premature stop)
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:10510198?
Chromosome Band 67E4
Flanking Sequence
NCTTTNGTGCCACTTTTGTTTNTGNAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTC
GATATACAGACCGATAAAACACATGCAGTCAATCTTTACGCATGATTATCTTTAACGTAC
GTCGCAATATAGATTATCTTTCTAGGGTTAAAGGGGGTTTTCTGTAATCTCTCTTTAAAA
GGTGTTCACTTCTTATGTGTCCACGTGTATCTTTAGAAGTAGAGCCTCTGATGCTCCGCC
GCNGNTTATCCNCTT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE