Detailed Information [109693]

Strain Information
DGRC Number 109693
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Indy[KM0071]
Genotype w1118; PBac{EGFP-IV}IndyKM0071
Break points/Insertion Site 75E2
Related Genes Indy
Received Date 22 November 2012
Original Number 71
Chromosome 3L
Comments Expression Photo: KM0071

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:18832348 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 75E2
Inserted gene: Indy
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:18832348
Chromosome Band 75E2
Flanking Sequence
AACCGGCCCACTTTAGCTTCACCATTTTGATTATCTCCCCCTTTTAAAAAAAAAATTAGC
TGCAGATAAATAAACCTCGATATACATACCGATAAAACACATGCGTCAATTTTACGCATG
ATTATCTTTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAAAAACTCGTATTCGC
TTGGTACTTTAAAATGATTGGGCTGTCGACTGATATTATTCATATGATTTATATACCAAT
TAATATATACGAATTTATGAGTTTTTTATGGGTAAACCTGTAAAATTTCCCAATATTCTT
AGGTTAATTCTTATTAAATGCCACCACAAAGCAATCCGTTTAGTCATGCATGAAATAATT
ATTTTAAATGAAGAGAAAATGGAATATTCCTACAGAACTTTCACCAACGAAACAGTAAAA
TTGTGCACGTTTTAAGACAAATAAATACATGAAAAAATAGTAAACATTATTTTGGAAAAC
TTTAGATGGAAAATGCTGCGTCAGTTCAATAAAAATAGAACAGGAAGCGCTCCTGGACGT
AGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE