Detailed Information [109694]

Strain Information
DGRC Number 109694
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Aldh[KM0301] / SM6a
Genotype w1118; PBac{EGFP-IV}AldhKM0301 / SM6a
Break points/Insertion Site 30B1
Related Genes Aldh
Received Date 22 November 2012
Original Number 301
Chromosome 2L
Comments Expression Photo: KM0301

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:9388805 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 30B1
Inserted gene: Aldh
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 2L:9388805
Chromosome Band 30B1
Flanking Sequence
TCACCCACCTTTGGGATTAGCTGGTGAGGAAGAAAAGTTAGCTGCAGATAAATAAACCTC
GATATACAGACCGATCAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGT
CGCAATATGATTATCTTTCTAGGGTTAAAGACAGTTTAAGAGCGATGTAAGCTAGGAGTT
TCTTTAAAAATTCTGAAATATATATAGACAAATAAAAACCGTGCACATTGGATTTTCAAG
TTTTTTCTGCAAAAATGTTTACTATATACGAACTGCTCTAATTTCATTGGATCCCATTTA
ACATCTGGACAAAAACCACATTTGGCTCGCTTCCTAACCGCAATTCCTTTTCAATTAAAT
CGAACGAACGCTAGTTTTAATTGGTGACACTAAAGATAAAAAATGACAATGGTTAAATTT
ATGCAAATTTCCCTAGAGAAGAAATGAAAGCGCTCCTGGACGTAGCCTTCGGGCATGGCG
GACTTGAAGAAGTCGTGCTACTTCATGTGGTCGGGGCCCGGCTGAAGGACTGCACACCGG
ATAATAGTTTTGAGACACATCGGTGGGGGGGGTAGCGACTGAACCTCTGGCAGGCGGAAG
TCAAGGTGGATACGAAGGTGCGCCAAGGCACCCGTGCCCTGGCCGTGCCTCATGACCACC
TTGACCTACGGGCTGGCAGAGGGTTCAACCGCCACCCCCACCCCCAGAAACAGCAAAAAT
TTTTTCAAATCTCCCATGCCGGAAAGGCTACATCGAAGAACGACGTAAAGAGGGTGGCAC
GGGAATTTGCCCAATCTTAAGCTTGGGGGGATTTGACACGAGAGAACTAACCACTAAAAA
TGAACGGGTCCGCCACATTTGACACGCGAGGGGAAGTGCGGAGGAGCGGAACCGACACCG
AATTGTCTTGTTTTCGTCCTCTGTGCGAGGGGCTCTCCTCCGATCGTGAGACACAACCCA
CGTCATGATAGAAGGACAGAAGGATAGTGTGTATGTAGAGCAG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE