Detailed Information [109695]

Strain Information
DGRC Number 109695
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Ucrh[KM0318] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}UcrhKM0318 / TM6C, Sb1
Break points/Insertion Site 3LHet
Related Genes Ucrh
Received Date 22 November 2012
Original Number 318
Chromosome 3LHet
Comments Expression Photo: KM0318

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3LHet:607031 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 3LHet
Inserted gene: Ucrh
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3LHet:607031
Chromosome Band 3LHet
Flanking Sequence
CTTCCGGATACCTACCATTGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCT
TTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAATAATAATGATGATGAATTGAT
TGGAGAGTCCTTCATACTCCAGCAGGATAATGCTCCCTGTTATAAGACCAAACTGATTAC
TGTTTCTGAAAAATGTTTGCATAAAAACATTGGATTGGCCACCTCAAATTCCAGCCCTCA
ACTTAATAGAATACCCTTGGTTTAGTATTAAAACAAAGGCGTGCAAATACTTATGCCCAC
TAGTGTAGTATTACCTACCCAATTTCGCTTCTAAAAGGTTCTGATCACCAAAAGGCACAA
AACACGTATAAAACTCGATAAAGAGATTTGTTTATTTATGTTCTTATTTTTAAGCACTGC
CCTTCCCTTTAATGGAATTGACTTTAATGGTATTTACTTAAGCTTTGTAAAAAGACTGTG
CGAAACGCAATGATCTAACTCAGCAACATAGTCAAATAATTCTTCGATGCAAGTCTCAGT
TGTTTTGGATCGCCCATTAACACGATCATTGCACTCTTGGTACTTATTGTACAAGGATTC
TATGTGACCTTTAGCTTGACATTTTTCCTGTTGCATAAAAATCAGTTTAGTGTTATATTA
AATGATGTAAAGAAATCTTTTTTTACCCTTAAACTGCTTGAGGGTCAACTAAGTCCTCTT
CGTCATCAGCTCTGACGGCGGGAAGCGAAAACCAGTTCCTAAAGCCATTATTATGCTAAA
AGGAGAATTAACCTAGTCAGATTCAAAACAATATAGTACCAAATTTTATGATATGAACGT
AATTACATTTTTGAAAATAACTATACCTTAGACGCTATGATGCATTCAATGTATTTTATG
TAGCCTGTAATCTAGGAGGCCTGTACACTACACATACACGAAT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE