Detailed Information [109696]

Strain Information
DGRC Number 109696
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}RpS20[KM0175] / TM2
Genotype w1118; PBac{EGFP-IV}RpS20KM0175 / TM2
Break points/Insertion Site 93A1
Related Genes RpS20
Received Date 22 November 2012
Original Number 175
Chromosome 3R
Comments Expression Photo: KM0175

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:16648115 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 93A1
Inserted gene: RpS20
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:16648115
Chromosome Band 93A1
Flanking Sequence
CTTAGATATCTGTAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGATATACAGAC
CGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGCAATATGAT
TATCTTTCTAGGGTTAATCGGGGTTAGGTTGAACGGCCATCGCAGGCGCCCGGGATTGCG
AGTTGGCGAGGGCATGGCTTCTTCTACTATTGACTCGCAGAGTGAGAGGATTGTTCGGAA
ATGACATTCTTACCATTATTTACAAATTTGCATGGCCAAGATGCTCAAATCTTTGTATTT
TGAGGGCATGTCCTGGATGAAGACTTCGGGCTGGTTCGACTGGCGGAGTAGTGCTGCTTC
ATGTGGCGGGGTAGCGAAAAACCGAGGTCCGTCTTGCACGCGCCTAAGGTTTGAGATTTC
CAAAGAACCGGGCCGTGGGGGAGGGGGCCCACATGAAGAGCACGACTTCTTCAACCGCGC
GGTGCAGACGGCTTCTTCAGGTCCGCCTGCCCGAAGGCTACGTCCAGGATCGCTGCTCCT
CTACAATTATTGCACTACTTTGACTCGGTTGCTCGCTGACTAATGGAAAGCAATGCAATC
TCGCAATCGTCGAACTATAGCTACACTCTAGTTGCTGCTCGATTGCCTTGCAGATAATAC
ATTGCGAGCAATGACAGATACTCACGCGTTAACAGACGAGAGATATATGCTCGTAGTTAA
GATTTACTGCGCGCGCTGAGTGTTCTTCTTACGATTATATATGGGGTATATGATGTGCGA
TTGTTCTTCTTCTGATGCTCATAGAGGCTGACAGAGCTAGCACTGTTCCTGCTGATGCAT
CAGGATCACTGCACGCACTCTACACAACAAAGTCACTCTCGGGGAGAGAGACCCCACCCC
CTCTACTTAATATAAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE