Detailed Information [109697]

Strain Information
DGRC Number 109697
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Hsp83[KM0300]
Genotype w1118; PBac{EGFP-IV}Hsp83KM0300
Break points/Insertion Site 63B11
Related Genes Hsp83
Received Date 22 November 2012
Original Number 300
Chromosome 3L
Comments Expression Photo: KM0300

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:3193725 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 63B11
Inserted gene: Hsp83
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame,N terminal fusion is expected
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:3193725
Chromosome Band 63B11
Flanking Sequence
AAATTTTTAATACTCCGCTAATGAGAAAAAAAAATTAGCTGCAGATAAATAAACCTCGAT
ATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGC
AATATGATTATCTTTCTAGGGTTAAACAAAAATTAATCTTGTATTCTAGAAACCACATGT
AATTGTAAATAAAGGACAGTAATATATAATTAAAAGGCCTATTTGACACGATGTTTAATT
CATGCTAAAGCATAGAAACCTCTGGAAGATGCGTCAAGCGACAAAAAATAAAAGAAACCG
GCATTTTGAGTTAATTTGCACGTTGCCACCTCTAATTAAATAAAAAAAAATTCTTAAACT
TGGCTCCTAAAAATTTAAAATCAATATCTCACATTTGGGTCAAGAACATTCGAGATGCAC
AGGACCACGCAAAATGCACATTTTGGCCATAGCCACTGATAAACTATTCACTCTTTTCTT
TTAATTTGCATTACTCACCTTGTATGTATGTTTTTCGTTCTATTCACAGAATAAAGGTAA
AAATACAGATATTTTCACTTTGCTTTGTATAGAATTGGAAATTCACAAAACTTTTCAGAC
GCTGCTTGTTGTTACGACGCACACCGTACGAAATTTTTTTCAGACTCGAACCGGCAAACG
CCGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATG
TGTCGGGGTAGCGAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE