Detailed Information [109698]

Strain Information
DGRC Number 109698
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Ald[KM0226] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}AldKM0226 / TM6C, Sb1
Break points/Insertion Site 97A6
Related Genes Ald
Received Date 22 November 2012
Original Number 226
Chromosome 3R
Comments Expression Photo: KM0226

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:22087012 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 97A6
Inserted gene: Ald
Protein trap?: Yes
Insertion into Intron or Exon?: Intron(5'UTR), Exon(5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:22087012
Chromosome Band 97A6
Flanking Sequence
NTTTGTTTCTGAAGGNAGAAAAAATAGCTGCAGATAAATAAACCTCGATATACAGACCGA
TAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCCGCAATATGATTA
TCTTTCTAGGGTTAAGGGGCTCAGGGGTTCTGTTCACTGCGTATGACGCCCACTCACCGA
ACTGGAAACTGAATCTGGGATGTGGTGATTAGCTGCTGGCTACTGGCTGGGTCCGCTGCT
GCTGCTGCACTGGAG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE