Detailed Information [109699]

Strain Information
DGRC Number 109699
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}shep[KM0309]
Genotype w1118; PBac{EGFP-IV}shepKM0309
Break points/Insertion Site 64C8
Related Genes shep
Received Date 22 November 2012
Original Number 309
Chromosome 3L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:5181477 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 64C8
Inserted gene: shep
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:5181477
Chromosome Band 64C8
Flanking Sequence
ACTGACGGGGTCATCCGATTCGGGTGCGGCCTATATTCCTATAGTAAGCTCCACGTCCGT
GCTCAACATTTTGATTATCCGTCAAAAAAAAAAAATTTGCTGCAGATAAATAAACTACGC
TATACTGACCGATAAAACACATGCGTCATTTTACGCTTGATTATCTTTATCGGACGTCGC
AATATGATTATCTTTCAAGGGTTAAAAAGGATCGCCTTGCAAATGCTTCTTTGAGTATGT
TTCAAGATAAATACCCGCCCCACCAAAAATGGAATTAGTGATATATGGGTATATCTCATA
AACATATGGTGAAATATGTATATGAACTATTACCGATATCTTAGCATATATTGGGATCTT
CTGATATGCATAGGGGAACATTATGACAGCAGATAATGTTTTCAGTGGAACTGATCTCAA
AGCGATTAGTATTTTTCCTAGCTAGAGTAAATATTTTTACTTTTCTAATTTAGTTTTAGT
GGCTAGCACTATTAACGAGACCTCCGCTGTGTTGGGCAAACATTTTTATTGCATGTCGCC
TATCAATCGCTGGCAATTGTGGTTGTTAACGACGCACCAACTGCGCCTCTGGACGTAGCC
TTCGGGCTTGGCGGACTTGAAAAAGTCGTGCTGCTTCATGTGGTCGGGGTATCGA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE