Detailed Information [109701]

Strain Information
DGRC Number 109701
Genotype with FlyBase Link w[1118] PBac{EGFP-IV}regucalcin[KM0305]
Genotype w1118 PBac{EGFP-IV}regucalcinKM0305
Break points/Insertion Site 11A1
Related Genes regucalcin
Received Date 22 November 2012
Original Number 305
Chromosome X
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: X:11907334 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 11A1
Inserted gene: regucalcin
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame,N terminal fusion is expected
General Information Kyoto_piggyTrap
Last update 2016-06-08
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point X:11907334
Chromosome Band 11A1
Flanking Sequence
GTTAATTTATTTTATTATAAAATTATTTATAAGTTATTTCACTTCTGTTTACCCTGACTC
CTCGCCTTAACCTCCTCGGCCTTGCTCACCATTTTGATTATCTGTTAGGAAGAAAAAATT
AGCTGCAGATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCATTTTTACGC
ATGATTATCTTTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAATTAATTGCTGT
AAGATTTATGGGCATTATTGATAAGGAAAGCGCTCCTGGACGTAGCCTTCGGGCATGGCG
GACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGACCGGCGAGGGCGAGGGCG
ATGCCACCTACGGCAAGCTGACCCTGATGTTCATCTGCGCCTACGGCAAGCTGACCCTCT
ACCCCTGGGCTGGCCGAGACGCCCTCTCCGCCATGCCCGACCGCTACTTCCAGGAACTTA
TCCTTATCAAAAAGGCCCATATATCGTAAGAAGTAATTAACCACGAACGATAATCGATTG
CGAGTAGTTAAAGATAAGCGGCGGAAAATTGACCCGAGCTTTTTGTTCGCTTATAGGGTA
AAATTATCGCACCTATTTTTCTCTTACAATGATAATGCTTGGAGCAGGGCAGGATGTTAT
AACGGGGCGGGCCACCCGAATCCGGTGAACG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE