Detailed Information [109702]

Strain Information
DGRC Number 109702
Genotype with FlyBase Link w[1118] PBac{EGFP-IV}Gmap[KM0132]
Genotype w1118 PBac{EGFP-IV}GmapKM0132
Break points/Insertion Site 13C5
Related Genes Gmap
Received Date 22 November 2012
Original Number 132
Chromosome X
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: X:15396833 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 13C5
Inserted gene: Gmap
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS/5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2016-06-08
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point X:15396833
Chromosome Band 13C5
Flanking Sequence
ACGGCCCAAATTTTGGGATTATCTGTAAGGAAAGAAAATTAGCTGCAGATAAATAAACCT
CGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG
TCGCAATATGATTATCTTTCTAGGGTTAAATAAAATTAACAACGACGAGCAACGGGAAAC
GGGCCACGAAATAAATATTTGAAAAAATATGGCAAGCTAATTAAAATTACCTCAAACGAC
ATGCATGTGTCTATGCACACATCTCTGACTTTACGGCGATGAATCACAAAGGTTCGCCTT
TGCCAGTCATTTGAATAGGTTTTGTGATTTGGAATACGGTTTCGCTAATGATAGCCAATA
TAACTGGTACTAATGGGAACTCAGATAAACAGAGATACGAAAAAATTACTTTAAAATCAA
CAGGCATTGTATAGACTAGCTTGGAATAGTACCGACTGAACTAAACGAATAACCATCCTT
ATGAAATTATTATTTTTTTTTTTTGGAACTTTAAAAACCACCCCCCCGGGACTAACCCTT
CGGGCAGGGGGAATTTAAAAAATCCGGGTAAAGGGCCCCCCCGGGGGGGGGCGGGGGAAA
AAAAAAAAATAAAAATATAAAAAAAAGCCGAAGTGGAGGGAAAACCCCCAGGGGGGGGGT
AAAAAAAAATTTTTATTTGGTGGGGAATTTTTTTTTTAATGTGTTTTTTGTTGGGCGCGG
TTTCGCGTTCCCCCCCGTTTTTTTTTTTTTTTCCCCGTAAAAAAAAAATCATAGGAGGGG
AGGCTAAAAAAAAGAGGCTGAAAAAATCCGGGGGGTTTTTCCGCGCGGTGTTCGGGGTTG
TGTTATTTGCGGTTATTTTTTTCTTCCTCTGCGCGAGTTACCCACAACAAAGATAAGACG
AAGGAGATGTGTGCCCGGGCGAGTGTCCCCGCCGCCACTTACAGCGCTGCTCGCTCACGA
AACTGATCACTCCAGCCGACACGATGTTTAATCTATATACAGCCGTGT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE