Detailed Information [109703]

Strain Information
DGRC Number 109703
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}sin3A[KM0219]
Genotype w1118; PBac{EGFP-IV}sin3AKM0219
Break points/Insertion Site 49B7
Related Genes Sin3A
Received Date 22 November 2012
Original Number 219
Chromosome 2R
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2R:8476656 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 49B7
Inserted gene: Sin3A
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation, but wrong frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 2R:8476656
Chromosome Band 49B7
Flanking Sequence
GGGGTTAACNCNTNNCCCNCCNNACATCTGAAGNNAGAAAAAANTAGCTGCAGATAAATA
AACCTCGATATACAGACCGATAAAACACATGCGTCAATCTTTACGCATGATTATCTTTAA
CGTACGTCGCAATATGATTATCTTTCTAGGGTTAAAACAGCGAAACGCGACGGCCAGTCA
TTTGGAGTCAGCAGAGAGAGCGAAATGAGTGTAAAACGGAGAGCGTGAGAGCGCGCGCGC
AGTGTTGCTTTGGAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE