Detailed Information [109706]

Strain Information
DGRC Number 109706
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Caps[KM0037] / Df(4)ED6366, P{w[+mW.ScerFRT.hs3]=3'.RS5+3.3'}CG2316[ED6366]
Genotype w1118; PBac{EGFP-IV}CapsKM0037 / Df(4)ED6366, P{w+mW.ScerFRT.hs3=3'.RS5+3.3'}CG2316ED6366
Break points/Insertion Site 102F8
Related Genes Caps
Received Date 22 November 2012
Original Number 37
Chromosome 4
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 4:1236371 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 102F8
Inserted gene: Caps
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame and premature stop codon
General Information Kyoto_piggyTrap
Lethality lethal
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 4:1236371
Chromosome Band 102F8
Flanking Sequence
CCTTGCCCCTTTTGTTTCTGAAGCAAGAAAAAATTAGCTGCAGATAAATAAACCTCGATA
TACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGCA
ATATGATTATCTTTCTAGGGTTAATCTGGCAAATCGATAAAAATTTACAAGAGTAATAAA
AATATGANAAAATATCAAACCATTTTTGTGGGCGTTAGATTGGGCGTGGAAACATGAGTA
TGATATTACTATTAC
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE