Detailed Information [109707]
 

Strain Information
DGRC Number 109707
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}shot[KM0008]
Genotype w1118; PBac{EGFP-IV}shotKM0008
Break points/Insertion Site 50C9
Related Genes shot
Received Date 22 November 2012
Original Number 8
Chromosome 2R
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2R:9786048 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 50C9
Inserted gene: shot
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2025-10-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 2R:9786048
Chromosome Band 50C9
Flanking Sequence
NTTTATGCGTCCNTTTACGCAGACTATCTNTCTAGGGTTAAGCAACNAGCTCTGTGCCTG
CTACGAAAATATTTGTTTGCAAATATTTAGGAGGCAATTACCATATTGTTTAAATGGAGT
TCAGATCACTCTCGGCATGGACGAGCTGTACAAGGTAAGTACTCGAGGGGTCCTAAATGC
ACAGCGACGGATTCTCGCTATTCNNANAGA
Sequence Comment iPCR (5' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE