| Strain Information | |
|---|---|
| DGRC Number | 109707 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}shot[KM0008] |
| Genotype | w1118; PBac{EGFP-IV}shotKM0008 |
| Break points/Insertion Site | 50C9 |
| Related Genes | shot |
| Received Date | 22 November 2012 |
| Original Number | 8 |
| Chromosome | 2R |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 2R:9786048 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 50C9 Inserted gene: shot Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2020-11-11 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 2R:9786048 |
| Chromosome Band | 50C9 |
| Flanking Sequence | NTTTATGCGTCCNTTTACGCAGACTATCTNTCTAGGGTTAAGCAACNAGCTCTGTGCCTG CTACGAAAATATTTGTTTGCAAATATTTAGGAGGCAATTACCATATTGTTTAAATGGAGT TCAGATCACTCTCGGCATGGACGAGCTGTACAAGGTAAGTACTCGAGGGGTCCTAAATGC ACAGCGACGGATTCTCGCTATTCNNANAGA |
| Sequence Comment | iPCR (5' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |