Strain Information | |
---|---|
DGRC Number | 109707 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}shot[KM0008] |
Genotype | w1118; PBac{EGFP-IV}shotKM0008 |
Break points/Insertion Site | 50C9 |
Related Genes | shot |
Received Date | 22 November 2012 |
Original Number | 8 |
Chromosome | 2R |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 2R:9786048 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 50C9 Inserted gene: shot Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2020-11-11 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 2R:9786048 |
Chromosome Band | 50C9 |
Flanking Sequence | NTTTATGCGTCCNTTTACGCAGACTATCTNTCTAGGGTTAAGCAACNAGCTCTGTGCCTG CTACGAAAATATTTGTTTGCAAATATTTAGGAGGCAATTACCATATTGTTTAAATGGAGT TCAGATCACTCTCGGCATGGACGAGCTGTACAAGGTAAGTACTCGAGGGGTCCTAAATGC ACAGCGACGGATTCTCGCTATTCNNANAGA |
Sequence Comment | iPCR (5' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |