| Strain Information | |
|---|---|
| DGRC Number | 109709 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}Kap-alpha3[KM0030] / TM6C, Sb[1] |
| Genotype | w1118; PBac{EGFP-IV}Kap-α3KM0030 / TM6C, Sb1 |
| Break points/Insertion Site | 85D25 |
| Related Genes | Kap-alfa3 |
| Received Date | 22 November 2012 |
| Original Number | 30 |
| Chromosome | 3R |
| Comments | Expression Photo: KM0030 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 3R:5402450 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 85D25 Inserted gene: Kap-alfa3 Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 3R:5402450 |
| Chromosome Band | 85D25 |
| Flanking Sequence | TGGNCCCNTTTGANTATCTGTAAGNCCAGANAAAATTAGCTAGCAGCATAAATAAACCTC GATATACAGNACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG TCGCANTATGATTATCTTTCTAGGGTTAAAACAAAGAAAGTGCTGAGAGGNAAAGCTGAA CGTANCTCGTTGGTNTGAGCCGATGTGCCAGAGGCATCGTTGGTCAANNCCCNGNCCGGC CTCGAACTGGAGCAT |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |