Detailed Information [109710]
Strain Information
DGRC Number 109710
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}endos[KM0105] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}endosKM0105 / TM6C, Sb1
Break points/Insertion Site 70C15
Related Genes endos
Received Date 22 November 2012
Original Number 105
Chromosome 3L
Comments Expression Photo: KM0105

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:14023761 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 70C15
Inserted gene: endos
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3L:14023761
Chromosome Band 70C15
Flanking Sequence
GCCCCTTTTNTTTCTGAACGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGATATACA
GACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGCAATAT
GATTATCTTTCTAGGGTTAAACAACGGGTACTAAATACTACTAAATAATATTATTATTAT
TATTTTTAATTGATATTCATATTACAGGGTTTGGGTATCCCCGAACACCGAAAGTTAGTA
AACTTATTGTTTGAT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE