Detailed Information [109711]

Strain Information
DGRC Number 109711
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}unc-115[KM0079] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}unc-115KM0079 / TM6C, Sb1
Break points/Insertion Site 85E4
Related Genes unc-115, Unc-115a, Unc-115b
Received Date 22 November 2012
Original Number 79
Chromosome 3R
Comments Expression Photo: KM0079

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:5516073 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 85E4
Inserted gene: unc-115
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:5516073
Chromosome Band 85E4
Flanking Sequence
CCTTGCTCCACCNTGNTATCTGTAAGGNAAGAAAAAATTAGCTTGCAGATAAATAAACCT
CGATATACAGACCGATAAAACACATGCAGTCAATTTTACGCATGATTATCTTTAACGTAC
GTCGCAATATGATTATCTTTCTAGGGTTAAACTCGGGATTGTTGTGTTGGAGTCTCGAGA
ATTATCTCAGTACCAGCGGTTTATCATCTGTAGATCTTGAAGTTCACCTTGATGCCTGTT
CTTCTGCTTGTCGGC
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE