Detailed Information [109713]

Strain Information
DGRC Number 109713
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Vha100-1[KM0209] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}Vha100-1KM0209 / TM6C, Sb1
Break points/Insertion Site 98F12
Related Genes Vha100-1
Received Date 22 November 2012
Original Number 209
Chromosome 3R
Comments Expression Photo: KM0209

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:24957666 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 98F12
Inserted gene: Vha100-1
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Lethality lethal
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:24957666
Chromosome Band 98F12
Flanking Sequence
GGGTNANAGCNGNANNCCCNCNNCNTCTGNAANGNAGAAAAAATTAGCTGCAGATAAATA
AACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAAC
GTGCGGCGCAATGTGATTATCTTTCTAGGGTTAAAGGGGACGTTTCANGGAATACCGAGT
TCGCNAATGAGGTANGGGGTATGNTTGTGTTNNANGNGGGGGGGGGGGGGGGGGGGGTCN
CNNNGNCNNANANNN
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE