Detailed Information [109714]

Strain Information
DGRC Number 109714
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Cnx99A[KM0178]
Genotype w1118; PBac{EGFP-IV}Cnx99AKM0178
Break points/Insertion Site 99A7
Related Genes Cnx99A
Received Date 22 November 2012
Original Number 178
Chromosome 3R
Comments Expression Photo: KM0178

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:25144598 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 99A7
Inserted gene: Cnx99A
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:25144598
Chromosome Band 99A7
Flanking Sequence
CTTGCCCCNTTTTGNTATCTGAAGNAAGAAAAAATTAGCTGCAGATAAATAAACCTCGAT
ATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCGC
AATATGATTATCTTTCTAGGGTTAAATAGAAGCTCTGCTCAATAAACCTCCGATGTAACC
TGTGGAGCNACAGATTAGCGCATTCTTGGGGCTGCCATGGGGAGTTGCTATCTGCTTGAC
CTCGTCTGTGGGTAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.


CLOSE