Detailed Information [109715]
 

Strain Information
DGRC Number 109715
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Fas1[KM0036] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}Fas1KM0036 / TM6C, Sb1
Break points/Insertion Site 89D5
Related Genes Fas1
Received Date 22 November 2012
Original Number 36
Chromosome 3R
Comments Expression Photo: KM0036

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:12453932 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 89D5
Inserted gene: Fas1
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:12453932
Chromosome Band 89D5
Flanking Sequence
TTTNCTTGCTCCCNTTTGATTCTGAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCG
ATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTC
GCAATATGATTATCTTTCTAGGGTTAAGAAGTAACTTTAAAATGGATTTCCCAAGCCTGA
CTTTTTGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGAC
GTTGTGGCTGTTGTA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE