Strain Information | |
---|---|
DGRC Number | 109716 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}zetaCOP[KM0086] / TM6C, Sb[1] |
Genotype | w1118; PBac{EGFP-IV}ζCOPKM0086 / TM6C, Sb1 |
Break points/Insertion Site | 73B6 |
Related Genes | zetaCOP |
Received Date | 22 November 2012 |
Original Number | 86 |
Chromosome | 3L |
Comments | Expression Photo: KM0086 |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 3L:16665537 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 73B6 Inserted gene: zetaCOP Protein trap?: Yes Insertion into Intron or Exon?: Intron(CDS), Exon(CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame(coding intron) , but wrong frame(coding exon) |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 3L:16665537 |
Chromosome Band | 73B6 |
Flanking Sequence | NNNTTAACNCNTGNCCCAANNTGATATCAGAAGGAAGAAAAACAGCTGCAGATAAATAAA CCTCGATATACAGACCGATAAAACACATGCGTCAAANNTACGCATGACTATCTNCTAACG TACGTCGCAATATGATTATCTCCTCTAGGGTTAAGGGTGTTAGTTACCTGGGCAACGGTC TGTTCGGCAATGGGAATGTCATCGTTGCGCAGATCTTGAAGTTCACCTTGATGCCGTTCT TCTGCTTGTCGGCCA |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |