| Strain Information | |
|---|---|
| DGRC Number | 109720 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}Bsg[KM0038] / SM6a |
| Genotype | w1118; PBac{EGFP-IV}BsgKM0038 / SM6a |
| Break points/Insertion Site | 28E4 |
| Related Genes | Bsg |
| Received Date | 22 November 2012 |
| Original Number | 38 |
| Chromosome | 2L |
| Comments | Expression Photo: KM0038 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 2L:8087144 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 28E4 Inserted gene: Bsg Protein trap?: No Insertion into Intron or Exon?: Intron (5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame and premature stop codon |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 2L:8087144 |
| Chromosome Band | 28E4 |
| Flanking Sequence | NATTCCTTGCTCCCANTTTGATTATCTGTAAGGCAAGAAAAAATTAGCTGGCAGATAAAT AAACCTCGATATACAGCACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTA ACGTACGTCGCAATATGATTATCTTTCTAGGGTTAAGATAAAGCCCCAATGCAGTACTTT GAACAAATACGGGACTCCGTCCGTCCGTCCGTATCACCAACACCAATACTACCGCAACCA AAAACCACACCAACG |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |