Detailed Information [109726]
 

Strain Information
DGRC Number 109726
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}CG10311[KM0023] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}CG10311KM0023 / TM6C, Sb1
Break points/Insertion Site 89B13
Related Genes CG10311
Received Date 22 November 2012
Original Number 23
Chromosome 3R
Comments Expression Photo: KM0023
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:12181942 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 89B13
Inserted gene: CG10311
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame (5'UTR intron)
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:12181942
Chromosome Band 89B13
Flanking Sequence 
NNTCTTGCCCCANTTGATATCTGAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGA
TATACAGACCGATAAAACACATGCGTCAATCTTTACGCATGATTATCTTTAACGTACGTC
GCAATATGATTATCTTTCTAGGGTTAAGATGCATTCATTTTCTCTGCCAATTTGGGTCAG
CGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGT
GGCTGTTGTAGTTGT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE