Detailed Information [109734]
 

Strain Information
DGRC Number 109734
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Map205[KM0165] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}Map205KM0165 / TM6C, Sb1
Break points/Insertion Site 100E3
Related Genes Map205
Received Date 22 November 2012
Original Number 165
Chromosome 3R
Comments Expression Photo: KM0165
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:27889419 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 100E3
Inserted gene: Map205
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:27889419
Chromosome Band 100E3
Flanking Sequence 
CTTTNNTGCCCCTTTTGTTATCTGNAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTC
GATATACAGACCGATAAAACACATGCGTCAATCTTTACGCATGATTATCTTTAACGTACG
TCGCAATATGATTATCTTTCTAGGGTTAACTATGCTTTTCGATGAACACTCCCCAAAGCA
TTACGCCAATGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCT
GCTTCATGTGGTCGG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE