| Strain Information | |
|---|---|
| DGRC Number | 109753 |
| Genotype with FlyBase Link | w[1118] PBac{EGFP-IV}nonA[KM0061] |
| Genotype | w1118 PBac{EGFP-IV}nonAKM0061 |
| Break points/Insertion Site | 14B18 |
| Related Genes | nonA |
| Received Date | 22 November 2012 |
| Original Number | 61 |
| Chromosome | X |
| Comments | Expression Photo: KM0061 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: X:16256457 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 14B18 Inserted gene: nonA Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | X:16256457 |
| Chromosome Band | 14B18 |
| Flanking Sequence | TNCTTNNGNCCNTTTTGTTTCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCG ATATACAGACCGATAAAACACATGCGTCAATCTTTACGCATGATTATCTTTAACGTACGT CGCAATATGATTATCTTTCTAGGGTTAAGGTGGGTACAAATACATATTGGCCCAATAAAT AATGTTAATTCTTTTCTCTTAGAAAAGTCAAGAACATTTACTCGTTTATACATATGTACA TACATATTTTCTACT |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |