| Strain Information | |
|---|---|
| DGRC Number | 109763 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}vkg[KM0131] |
| Genotype | w1118; PBac{EGFP-IV}vkgKM0131 |
| Break points/Insertion Site | 25C1 |
| Related Genes | vkg |
| Received Date | 22 November 2012 |
| Original Number | 131 |
| Chromosome | 2L |
| Comments | Expression Photo: KM0131 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 2L:5021283 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 25C1 Inserted gene: vkg Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 2L:5021283 |
| Chromosome Band | 25C1 |
| Flanking Sequence | NACTTGNGNNNANTTTTNTTATCTGAACANAGAAAAAATTAGCTGCAGATAAATAAACCT CGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG TCGCAATATGATTATCTTTCTAGGGTTAATGCCAATTGCGCCAGTTGCCCGTCCAGCCAA GCATTCAAGCATCCAANCTTTTGGTTTAAGGTCANGAGCGAGGNCTCCACGCGGATATAT CTTGATATCTGGCAN |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |