Strain Information | |
---|---|
DGRC Number | 109772 |
Genotype with FlyBase Link | w[1118] PBac{EGFP-IV}CG3011[KM0094] |
Genotype | w1118 PBac{EGFP-IV}CG3011KM0094 |
Break points/Insertion Site | 5C7 |
Related Genes | CG3011 |
Received Date | 22 November 2012 |
Original Number | 94 |
Chromosome | X |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: X:5810008 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 5C7 Inserted gene: CG3011 Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2023-02-13 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | X:5810008 |
Chromosome Band | 5C7 |
Flanking Sequence | GNNGNNNNGNNNNGGNGNGGGGGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GNTTNNNNTNAACCGCNCGGGNGGGAACAAACGCATATCTGNGAANGNCNNAAAAANTAG CTGCAGATAAATTAAACCTCGATATACAGCACCGATAAAACACATGCGTCAATCTTTACG CATGATTATCTTTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAACAATGATACT ACTATAAACAACACT |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |