Strain Information | |
---|---|
DGRC Number | 109774 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}CG1943[KM0126] |
Genotype | w1118; PBac{EGFP-IV}CG1943KM0126 |
Break points/Insertion Site | 84B2 |
Related Genes | CG1943 |
Received Date | 22 November 2012 |
Original Number | 126 |
Chromosome | 3R |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 3R:2901312 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 84B2 Inserted gene: CG1943 Protein trap?: No Insertion into Intron or Exon?: Intron (5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation, but wrong frame |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 3R:2901312 |
Chromosome Band | 84B2 |
Flanking Sequence | CNCTCCTTGCCCCNNTTGTTTCTGAACGAAGAAAAAATTAGCTGCAGATAAATAAACCTC GATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGT CCGCAATATGATTATCTTTCTAGGGTTAAAACTCGAAATTTCGGCCTGCTGCCATCGCCG CGACTTGTTGACCAAGTGAATGTTTATGGCCAAAACACATTAGACAAATCCAGTTTCGGC AGACCTACTTAAAAC |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |