Detailed Information [109786]
 

Strain Information
DGRC Number 109786
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}eIF5B[KM0034]
Genotype w1118; PBac{EGFP-IV}eIF5BKM0034
Break points/Insertion Site 63E1
Related Genes eIF5B
Received Date 22 November 2012
Original Number 34
Chromosome 3L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:3455900 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 63E1
Inserted gene: eIF5B
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3L:3455900
Chromosome Band 63E1
Flanking Sequence
NNNGNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNANAAACNNNGGC
GCANAAANGNNTAGNANTAGGAACNCAAAANTAGCTGCAGNTAAATAAACCTCGATATAC
AGACCGATAAAACACATGCGTCAATTTTACGCCNTGATTATCTTTAACGTACGTCGCAAT
ATGATTATCTTTCTAGGGNTAAAAAGCGAGGCAATCTCGATCTTGAAGTTCANTTTNTTG
CCNTTCTTCNGCTTG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE