Strain Information | |
---|---|
DGRC Number | 109973 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}KM0608 |
Genotype | w1118; PBac{EGFP-IV}KM0608 |
Break points/Insertion Site | 93F14 |
Received Date | 31 March 2014 |
Original Number | KM0608 |
Chromosome | 3R |
Original Source | Hiroshi Matsubayashi, Kyoto Institute of Technology |
Original Comments | No annotated gene. Insertion site: 3R: 17688531 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 93F14 Inserted gene: Protein trap?: Insertion into Intron or Exon?: Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Insertion Point | 3R: 17688531 |
Chromosome Band | 93F14 |
Flanking Sequence | GTTTGTGTGGGAGNAGAAANAATTNCCNGCAATATTAACCTCGATATACAGACCGATNAA ACGNNGCNTCATTTTTNCNCANGATTATCTTTAACGTACGTCNCATTANGATTANCTTTC TGAGGGTTAANGTGTAATGCGATCTGCGGCGCTCCNGGACGTACCCTTCGGGCATGGCGN ATTGAAAAAAATCATAGAAAA |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |