| Strain Information | |
|---|---|
| DGRC Number | 109973 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}KM0608 |
| Genotype | w1118; PBac{EGFP-IV}KM0608 |
| Break points/Insertion Site | 93F14 |
| Received Date | 31 March 2014 |
| Original Number | KM0608 |
| Chromosome | 3R |
| Original Source | Hiroshi Matsubayashi, Kyoto Institute of Technology |
| Original Comments | No annotated gene. Insertion site: 3R: 17688531 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 93F14 Inserted gene: Protein trap?: Insertion into Intron or Exon?: Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 3R: 17688531 |
| Chromosome Band | 93F14 |
| Flanking Sequence | GTTTGTGTGGGAGNAGAAANAATTNCCNGCAATATTAACCTCGATATACAGACCGATNAA ACGNNGCNTCATTTTTNCNCANGATTATCTTTAACGTACGTCNCATTANGATTANCTTTC TGAGGGTTAANGTGTAATGCGATCTGCGGCGCTCCNGGACGTACCCTTCGGGCATGGCGN ATTGAAAAAAATCATAGAAAA |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |