Detailed Information [112001]
 

Strain Information
DGRC Number 112001
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0001 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0001 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 31F4
Map Viewer
Related Genes CG13144 CG6094 Myo31DF
Original Number 1
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0001

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1151
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells, hg
Larval GFP gut
Larval X-gal gut
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Ikegawa Y, Combet C, Groussin M, Navratil V, Safar-Remali S, Shiota T, Aouacheria A, Yoo SK.
Evidence for existence of an apoptosis-inducing BH3-only protein, sayonara, in Drosophila.
EMBO J (2023) 42(8) e110454 [PubMed ID = 36727601] [RRC reference]

Aggarwal P, Liu Z, Cheng GQ, Singh SR, Shi C, Chen Y, Sun LV, Hou SX.
Disruption of the lipolysis pathway results in stem cell death through a sterile immunity-like pathway in adult Drosophila.
Cell Rep (2022) 39(12) 110958 [PubMed ID = 35732115] [RRC reference]

Takemura M, Bowden N, Lu YS, Nakato E, O'Connor MB, Nakato H.
Drosophila MOV10 regulates the termination of midgut regeneration.
Genetics (2021) 218(1) [PubMed ID = 33693718] [RRC reference]

Shen JL, Fortier TM, Zhao YG, Wang R, Burmeister M, Baehrecke EH.
Vmp1, Vps13D, and Marf/Mfn2 function in a conserved pathway to regulate mitochondria and ER contact in development and disease.
Curr Biol (2021) 31(14) 3028-3039.e7 [PubMed ID = 34019822] [RRC reference]

Dong W, Zhang X, Kong Y, Zhao Z, Mahmoud A, Wu L, Moussian B, Zhang J.
CYP311A1 in the anterior midgut is involved in lipid distribution and microvillus integrity in Drosophila melanogaster.
Cell Mol Life Sci (2022) 79(5) 261 [PubMed ID = 35478270] [RRC reference]

Bjedov I, Cocheme HM, Foley A, Wieser D, Woodling NS, Castillo-Quan JI, Norvaisas P, Lujan C, Regan JC, Toivonen JM, Murphy MP, Thornton J, Kinghorn KJ, Neufeld TP, Cabreiro F, Partridge L.
Fine-tuning autophagy maximises lifespan and is associated with changes in mitochondrial gene expression in Drosophila.
PLoS Genet (2020) 16(11) e1009083 [PubMed ID = 33253201] [RRC reference]

Nagai H, Tatara H, Tanaka-Furuhashi K, Kurata S, Yano T.
Homeostatic Regulation of ROS-Triggered Hippo-Yki Pathway via Autophagic Clearance of Ref(2)P/p62 in the Drosophila Intestine.
Dev Cell (2021) 56(1) 81-94.e10 [PubMed ID = 33400912] [RRC reference]

Izumi Y, Furuse K, Furuse M.
The novel membrane protein Hoka regulates septate junction organization and stem cell homeostasis in the Drosophila gut.
J Cell Sci (2021) 134(6) [PubMed ID = 33589496] [RRC reference]

Hudry B, de Goeij E, Mineo A, Gaspar P, Hadjieconomou D, Studd C, Mokochinski JB, Kramer HB, Placais PY, Preat T, Miguel-Aliaga I.
Sex Differences in Intestinal Carbohydrate Metabolism Promote Food Intake and Sperm Maturation.
Cell (2019) 178(4) 901-918.e16 [PubMed ID = 31398343] [RRC reference]

Kim J, Kim H, Noh SH, Jang DG, Park SY, Min D, Kim H, Kweon HS, Kim H, Aum S, Seo S, Choi CS, Kim H, Kim JW, Moon SJ, Gee HY, Lee MG.
Grasp55-/- mice display impaired fat absorption and resistance to high-fat diet-induced obesity.
Nat Commun (2020) 11(1) 1418 [PubMed ID = 32184397] [RRC reference]

Nagai H, Kurata S, Yano T.
Immunoglobulin superfamily beat-Ib mediates intestinal regeneration induced by reactive oxygen species in Drosophila.
Genes Cells (2020) 25(5) 343-349 [PubMed ID = 32080940] [RRC reference]

Redhai S, Pilgrim C, Gaspar P, Giesen LV, Lopes T, Riabinina O, Grenier T, Milona A, Chanana B, Swadling JB, Wang YF, Dahalan F, Yuan M, Wilsch-Brauninger M, Lin WH, Dennison N, Capriotti P, Lawniczak MKN, Baines RA, Warnecke T, Windbichler N, Leulier F, Bellono NW, Miguel-Aliaga I.
An intestinal zinc sensor regulates food intake and developmental growth.
Nature (2020) 580(7802) 263-268 [PubMed ID = 32269334] [RRC reference]

Izumi Y, Furuse K, Furuse M.
Septate junctions regulate gut homeostasis through regulation of stem cell proliferation and enterocyte behavior in Drosophila.
J Cell Sci (2019) 132(18) [PubMed ID = 31444286] [RRC reference]

Anding AL, Wang C, Chang TK, Sliter DA, Powers CM, Hofmann K, Youle RJ, Baehrecke EH.
Vps13D Encodes a Ubiquitin-Binding Protein that Is Required for the Regulation of Mitochondrial Size and Clearance.
Curr Biol (2018) 28(2) 287-295.e6 [PubMed ID = 29307555] [RRC reference]

Kurz CL, Charroux B, Chaduli D, Viallat-Lieutaud A, Royet J.
Peptidoglycan sensing by octopaminergic neurons modulates Drosophila oviposition.
Elife (2017) 6 [PubMed ID = 28264763] [RRC reference]

Dasari SK, Schejter E, Bialik S, Shkedy A, Levin-Salomon V, Levin-Zaidman S, Kimchi A.
Death by over-eating: The Gaucher disease associated gene GBA1, identified in a screen for mediators of autophagic cell death, is necessary for developmental cell death in Drosophila midgut.
Cell Cycle (2017) 16(21) 2003-2010 [PubMed ID = 28933588] [RRC reference]

Sun T, Song Y, Dai J, Mao D, Ma M, Ni JQ, Liang X, Pastor-Pareja JC.
Spectraplakin Shot Maintains Perinuclear Microtubule Organization in Drosophila Polyploid Cells.
Dev Cell (2019) 49(5) 731-747.e7 [PubMed ID = 31006649] [RRC reference]

Bader CA, Shandala T, Ng YS, Johnson IR, Brooks DA.
Atg9 is required for intraluminal vesicles in amphisomes and autolysosomes.
Biol Open (2015) 4(11) 1345-55 [PubMed ID = 26353861] [RRC reference]

Xu T, Nicolson S, Denton D, Kumar S.
Distinct requirements of Autophagy-related genes in programmed cell death.
Cell Death Differ (2015) 22(11) 1792-802 [PubMed ID = 25882046] [RRC reference]

Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51725_0227
Strand Minus
Insertion Point 10499195
Chromosome Band 2L
Flanking Sequence
ggtttttggtgcactgaccttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGG
TCGAGTGCGGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAAT
CCAGGTGGGCACTCACACCGATCNAAGAATACATANGAGAGAACCGTNNNCAANGAACCC
ATTATTGNTGGGGTNCGTNTTCAGGAAGGGCAAGCCATCCGACATGTGATCCTCTTNAGA
CCAATCAAATCCATGAAGAGCATNCNTGGGCATAAAATCCAACGGAATTGTGGAGTTATC
ATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTC
TTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTC
CACTGAAGCCATCTTATTCTGGATGACNAGCTGNCGAGGNANATGATNCACTCANCTGNT
GCTGACCTNAGGTACTACTCTTTTCNGATGATGATGTAGCNCTTATTTTATGCTGNCTNA
ATGNTAGAGGCATATCANNNTNCACTGAAGCCAATNTNNTNTGNNNNNNNNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnntn

Image Files
Disc

d1 (->Large)

CLOSE