Detailed Information [112095]
 

Strain Information
DGRC Number 112095
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0225 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0225 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40169 CG40181
Original Number 225
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0225

NP line. Received from the National Institute of Genetics.

Also known as NP225 P{GawB}NP225 GAL4-NP225 NP225Gal4
Balancer CyUW14
Cluster id 2091
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns (exit glia?), psp
Larval GFP asp
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Wu Y, Ren Q, Li H, Guo A.
The GABAergic anterior paired lateral neurons facilitate olfactory reversal learning in Drosophila.
Learn. Mem. (2012) 19(10) 478-86 [PubMed ID = 22988290] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04425_0711
Strand Plus
Insertion Point 2588802
Chromosome Band U
Flanking Sequence
gtgtatacttcggtaagcttcggctatcgacgggaccaccttatgttatttcatcatgTG
CTAGCTCTGCGCGTAGTTGCTGTAGCTCGAACATGTTTGTCTCCCTCTCACTGCCAGTTT
CGGTTGATTCTTTTCTGTTCATCGCATTCACACTTACGTGATCGAAGAATACATAAGAGA
GAACCCGTCGCCNAAGAACCCATTATTGGTGGGGTNCGTTTTCAGGAAGGGCAAGCCATC
CGACATGNNANNCTCTTNCANANCAATCNAATGCAAGNAGAGNNTCCCTGGGCATAAAAT
CCAACCGGAATTNNGGAGGTATNATGNATNAGCTNGCGGGNCAAATCCNNTCNANGGAAA
CTGNGTTTGNACCTTTGNTACCACCCTTNTTTTCCGAGNNAGATNGGGGCACNTTTNNTT
NATTGNTNTNNTTNAATGNGNGGAGGGCNTATAAAGGCNCNCCCCTGGAACCCANTNTTT
NTTTNGGGNNGAGNNTNAAAANTNNNAANNNAAGANGGNGAGCCNNCAANNGNGANAGCN
NANNGANNAANGACANCANACGAANNNNGNCNNNNNNATANANNANANGANNTNACCTNT
CNANCCNNACNGNANNCCCNNACCNNNGCGGNACNCNTNANANANNNCGNNNNCTNGTAC
NTGAANNNNNNGNGTGGTGGNNGNANTTTTTTNNATTANNNANANNNNGCGNTATNNTNN
NGGNNGNNCTCNNCCNCNCNCNTNNCNACNNTTNNAGNGNGNCTNNNNANNTCNNTCNNC
CTGCTCTNNNNNNACNTCGNnnttgntgngcnnnnnccatttncactncncnncagttgc
tactgntngncncngtnggttttnngtcnccttcannnancanttattngctgnnntagt
gnctnnncnttnntctnnaccggntnnnggnncncnccngnncncnagnnnnnttnctca
ccgtgactnctccgcccgnnnnnnccnncnncttnncccnct

Library Name / Clone Name np / np54643_0309
Flanking Sequence
GGGNGNNGNGGNGNGGGGGGGGNGGNNGGGGANAGGGCACCCAGGGGGNCANNNCAATTG
GGGGGNAAAAANNANCGAGACANNAGAGGGGNAGGGGGAGAGNCNCGACCGNGGCGCGGA
NGGNNAAACACCACAGAAGGGANAGAGGAAAAAAGACAGGCCAGNAGCAANCNANANAGN
CNGGANGAAGGCAGGGANAGGAGAAAAAAGACNGAGGNNAGGAAAAAAGANANCAAAGGN
NGNGNGGAGANNGNCGNNNNCGGANNCNNAAAAGNGNGCCGNNNGANCAAAGGGCNANAA
GANCGNACAAANCCNNAANAAACAGNAACCNCGAGNAAAGCCNGAANGGNANGCGACAAG
NGNANANGANGCCGNAGAGGNAAGNNAGGNGNGGANNACAGGGGGCCCNNNGNCGNNACC
NCCAGAGCNCTCANCGNGAGANCCAGGCNGGNNGAGNGAAAAGGGGAAAAANANGACNNN
NGGGANGAGAGNACAANANAGNGAANGAGGAGNGNCCGCGAAGAGNNGCNCANNNAGGNG
GGNGACAGNACGCNCCGNAANNCCGGCAGAGNNCNGGCNCNGNGGCNGNGANCCCAGAGA
GAAAANNNNGNANNNAAANAAGGNAAGAAAAAGGAGGAGACGGANGGAGGGGNAAGNGNN
GGNNNGAAGAANGNCNANCNCGGGGNGGANAGANAAANNNAAAGCGCGNAANCGGGANGN
ANANACGNNACNANCGGAANAAANGGGANCACNACGAGNANAGGAANAAANAAANNNNAA
AGNCAAGACAAAAGNGAANCggcgggnnaanagaacaaagagcganncngnanananaan
cnngncngacggnggcgagaancanngcacgancgcncnanacnngccanccgngnacng
tccncacgagncnangagcgnacaaagcggncgagaacnaanaggacnacacgagagaag
aagnaacnnaggagcgnagcnnaacgacgacgcatanganacagagcnagatncnacaan
aagganaacaannaaccacggaacancgaaggagnacngaannnacaacnnggaaaggtg
gganttggganacacaaaaagangctgnanngacnngggaaaaagggngcnngcanaaag
gggggggngnacncnngantcaaacgaatggcacacnnaanncgactncnccnaanagna
gggacaaacgaanacgnnaccgncganaaggcnagcgggggangaaaacacagnnaagaa
cggngagaagagcganagagaaancgaacaanncgccgnggnacaaanaaangcacaggn
ccaanaggaacgcgngcgcanattgaaacngngaggcgggacgnacagnnnacnnaaaan
ncncagnanaacaggaagagngaaaacnaacgcncgcaaagaaaagaanggtgangcgat
aagaaaaancacgcgaccanggcgcancaggangncggcncgcgccgnaaaaaangagnc
nnngacaganggcgngannagcancggacngnnaataaanaanagagaggggcnaaaaga
agcgcgnangaagagncacagggacnangattganggaatgggaaaananancnagaaaa
aaaacnaaccnanggnagcncannnccgcgcgnccacccngaacncnnccacgaaaanaa
aangaacnaaaaangcgacnggcggngaacngcgagngganannaaacaanncnggggaa
n

CLOSE