Detailed Information [112132]

Strain Information
DGRC Number 112132
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG6860[NP0317]
Genotype w*; P{w+mW.hs=GawB}CG6860NP0317
Break points/Insertion Site 36C7
Map Viewer
Related Genes CLIP-190 CG6860
Original Number 317
Comments FlyBase Insertion: P{GawB}NP0317

NP line. Received from the National Institute of Genetics.

Cluster id 1226
General Information NP_lines
Embryonic Expression epi
Larval GFP pns
Larval X-gal sg, dots on gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08325_0711
Strand Minus
Insertion Point 17362302
Chromosome Band 2L
Flanking Sequence
TTTGGGNNNAAAANCCNNTTTTTNTNCTNNNGNAAGCTCNNGNTTNGNCGGNACCCCTTN
TGTTATTTATNATGGCGCTGCCCAAGTAGCATCCCATAAACCGATTCAGTTGTTTTTCGA
TTTTCGTTGTGCACTGTCGCTCGTCCGCTGCGTGAGCTTGTGCGTGTGTGAGTGCGCGTG
TGTGCGAGGAGGCAAAGAAGAGGAAGCAAGANGGAAGCCGCAAAAGGAAAATCCAATTCC
GAGAAATCTTATCAATGAGCCAAGAAGACGTACACTAAATGAAAAATAATCGAGATGCGT
GCGTTTCAATAGAGCAAATTTAGTTTCTAGTTTCGGTTTCTTTCGGCACTTCACTCCGTT
TCCTTATCGGTGTGATAGTTTAGCGCGTGCGTGTGTGTGTGCAAGTGTGTGGAAGTGTCG
CCACGCCTACACGGGAAAATGGCAGCAAACGGTTTACCAACGCCTACATAGCGTCGCAGT
CGGGCGTCGGCAGCGCCCGCTGGCAGCGCCATCGGCAGCGGGGTCGGCTTCCCCTTCCAG
GATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGGTNGGGGTCCGT
TTTAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATTCATGAAGA
GCATNCCTGGGCATNAAAATCCAACGGNATTGGGGGAGTTATCATGATGAGCTGNCGAGT
CAATCGATACAGTCAACTGNCTTTGACCCTTTGGTACTACTCTCTTCCGATGATGATGTC
GCACTTATTCTATGCTGTCTcaatgttagaggcatatcagtctcctgccnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE