Detailed Information [112212]
 

Strain Information
DGRC Number 112212
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Pk61C[NP0548] / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}Pk61CNP0548 / TM3, Ser1
Break points/Insertion Site 61B1
Map Viewer
Related Genes Pk61C roo{}896
Original Number 548
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0548

NP line. Received from the National Institute of Genetics.

Balancer TM3 Ser
Cluster id 1718
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle subset, gut
Larval GFP fb
Larval X-gal sg, cns
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52505_0227
Strand Minus
Insertion Point 112436
Chromosome Band 3L
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgGGCGAGACTTTGACTTCCAAGCATTTGGCTCGAGCAGCGAAACCGA
TGGGAGACGAGCGCCACCCGAGAGAACTCTCTTTGGCGTTGCCGCCCCCGCCAAGCTAAC
CCTCGGCGCTCTCAGTTAAATGGGGCCAAAGCAGCGCAGTCGTGTCGCCGCTGGCGTCAC
AATTTTTTTTACAAGGCGAACAAGTTGCGCGCCACTTTTGAGAGCGTAATTGTTGCACTG
TAATTGTTTGCCAGTGACTTTTTATAAATAAACACGACGGGGCAAAGCGAAAACAAGTTT
CAGTCGAAATCCACACAACTACATAAGGCCAAAGAGAGCGCACGCTCTTTTTGAAGAGAG
AGAGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGNGGGGAGACNNCCGNNTTTCTANCTG
TANACAAGCNAGANGNGGANACTCTATAAAAGTGGGAAAGANACAGGGCGACAGGCTAAG
ANTGCGGCNCTGCTNNAAAAACTCGTTTTTCCCGNTGGAAAAGGAATATATGGATAAAAA
AGAATTCGAGGNATTNTCGCGCGAAAGANAAAGAGAAGTGGTGTAAAAATAAACAAGAAT
NCGNACCCGNTTACGAATACANACACAGGGCAACGANNGAAGAGAATTGGTATATCTGAA
AAACAGAGCGNACAAAACAAATGCTTGAAAGCGAGGGGGCATCTTAAAGCGNACAGCTGA
TNCGTAANAAACATNCCCCCggcggcnacttcaatgtaaataagtntataaccgggtttn
taagcnggttgagtgtgtccacaaccncggtnaccttatganacaaaccgggccanaaaa
ntgcaggngaaggcctttnnntt

Image Files
Disc

d1 (->Large)

CLOSE