Detailed Information [112275]

Strain Information
DGRC Number 112275
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}IP3K1[NP0668] / CyO
Genotype w*; P{w+mW.hs=GawB}IP3K1NP0668 / CyO
Break points/Insertion Site 30C9
Map Viewer
Related Genes CG18854 CG4026 CG4110
Original Number 668
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0668

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1137
General Information NP_lines
Embryonic Expression sg, fg, hg, psp, anal pud
Larval X-gal sg, gc, epi, tr
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np55793_0309
Strand Minus
Insertion Point 9774644
Chromosome Band 2L
Flanking Sequence
gnnggnggggnggngggnnngnccangggccggggggtttnggttttttggnnngganna
acnggggtcanaaacccccagttttacgttantggnagtctcttgccgacgggcaccacc
ttatgttatttcatcatgGTCTAGCGGCTCTGGATGGCGACTAACTGGTTTCGCCATATG
GCAGCCAGTTTTGTGATCCGCGNNCNNGNGCNTAGGCCACTNGCAAATTATTAAAAATAA
AACTANAAAAATAATTACNCNNAATTAATAAAAANAGAAACTTTAAACCAATCGGCGCAC
TANTNNGGGTTANGAGTNAATNAAAACCCNANGGNCATGCTAAGGGNNAANNANCANNNA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNN
NNNNCNANCNNNNGNNANNNNNNNNNGNNNNANCGNNNNNGNCAGGNNANGANNNGNNAN
NNNNNNNTGGCNGNNNNNNNNGGNAACNAANNGNNNNNGNNNNNNGNNNNNCNNNNNNGN
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nn

Library Name / Clone Name np / np09255_0727
Flanking Sequence
atttttnngtgcactgaatttaantgtatacttcggtaagncttcggctatcgacgggac
caccttatgttatttcatcatgCGCTAGACCACGTAACGCCACGATTTTCGCCGgatcga
agaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagg
aagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatcc
ctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgat
acagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttatt
ctatgctgtctcaatgttagaggcatatcagtctccactgagccatctttntttttnggg
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE