Detailed Information [112393]

Strain Information
DGRC Number 112393
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Prp38[NP0910] / CyO
Genotype w*; P{w+mW.hs=GawB}Prp38NP0910 / CyO
Break points/Insertion Site 45A12
Map Viewer
Related Genes CG30342 CG30344 CG8055
Original Number 910
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0910

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 618
General Information NP_lines
Embryonic Expression cns
Larval X-gal mt, hg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39775_0907
Strand Plus
Insertion Point 4205481
Chromosome Band 2R
Flanking Sequence
antnttttgggngnnaangncnttttttgtntacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgAACCGGCCTAAGGAGAATTCGACAGCAGTGAGACGA
CCACGGAGAGTTCGCTCCAAGTCAAGGTCCCGCAGTCGGGAGCGCGAGCGAAGATCNAAG
AATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGGTCCGTTTTCAGGA
AGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCC
TGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCANTCGATA
CAGTCAACTGTCTTTGACCTTNGTTACTACTCTCTTTNCGATGATGATGTCGCACTTATT
CTATGCTGTCTCAATGTTAGAGGCATATCAGCCTCCACTGAAGCCATCTTTTTTTGGGNN
NNNNNNNNNNNNNNAANNNNNANNNNNNNNACTTNNTTTTNNNCNNNNNNNANNNNNNNN
NNGNNNNNNNNNNNNNNNNNNNNANNNNANTNNNNNNNNGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnann


CLOSE