Strain Information | |
---|---|
DGRC Number | 112414 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP0952 / CyO |
Genotype | w*; P{w+mW.hs=GawB}NP0952 / CyO |
Break points/Insertion Site | 35D1; -; 35D2 |
Map Viewer | |
Related Genes | CG15258 nht esg |
Original Number | 952 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP0952 NP line. Received from the National Institute of Genetics. |
Balancer | CyO |
Cluster id | 1199 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | midline, ventral epi stripe, oenocyte, pns, leg |
Larval X-gal | uni disc, sg, gut |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np09705_0727 |
Strand | Plus |
Insertion Point | 15311837 |
Chromosome Band | 2L |
Flanking Sequence | tntttttnnannttantntcttnggggnnaaaaaccctttttttgtatacttcggtaagn ctncggctatcgacgggaccaccttatgttatttcatcatgATGCATACTCTCGGCGGAA CGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTAATGAGCCGAGTGCCGAGTGCAGG GGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGTTATTCCCAGACTCTAACNT NTTCACATAACCATCTCTCCCAACGCAATATACCCGAAATATAACCGATATTCAATCGCT TTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCgatcgaagaatacataagagagaa ccgtcgccaaagaacccattattggtgggggcccntttcagggaggggcaagccatcccg acatgttattctttttcagacccaatcaaattcatggaggagcattcctggggcataaaa nccaaccggaatttgggggagttatcatgaaggagctggccgangtcaatcgatccaggc aacctggcttttgacccttggtacctacttttnttccgaggaagangggcccacttaatt ctatggctgnctcaatggtagangcatatcaggctccactgagcatnnntttttnggggg nnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnanggnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |