Detailed Information [112414]
 

Strain Information
DGRC Number 112414
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0952 / CyO
Genotype w*; P{w+mW.hs=GawB}NP0952 / CyO
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 952
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0952

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression midline, ventral epi stripe, oenocyte, pns, leg
Larval X-gal uni disc, sg, gut
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np09705_0727
Strand Plus
Insertion Point 15311837
Chromosome Band 2L
Flanking Sequence
tntttttnnannttantntcttnggggnnaaaaaccctttttttgtatacttcggtaagn
ctncggctatcgacgggaccaccttatgttatttcatcatgATGCATACTCTCGGCGGAA
CGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTAATGAGCCGAGTGCCGAGTGCAGG
GGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGTTATTCCCAGACTCTAACNT
NTTCACATAACCATCTCTCCCAACGCAATATACCCGAAATATAACCGATATTCAATCGCT
TTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCgatcgaagaatacataagagagaa
ccgtcgccaaagaacccattattggtgggggcccntttcagggaggggcaagccatcccg
acatgttattctttttcagacccaatcaaattcatggaggagcattcctggggcataaaa
nccaaccggaatttgggggagttatcatgaaggagctggccgangtcaatcgatccaggc
aacctggcttttgacccttggtacctacttttnttccgaggaagangggcccacttaatt
ctatggctgnctcaatggtagangcatatcaggctccactgagcatnnntttttnggggg
nnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnanggnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE