Detailed Information [112417]

Strain Information
DGRC Number 112417
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0956 / CyO
Genotype w*; P{w+mW.hs=GawB}NP0956 / CyO
Break points/Insertion Site 28C4
Map Viewer
Related Genes CG14536 BEST:CK02318 CG7149
Original Number 956
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0956

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1092
General Information NP_lines
Embryonic Expression a small # of cells
Larval X-gal fb, sg, gut
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69095_0810
Strand Plus
Insertion Point 7782816
Chromosome Band 2L
Flanking Sequence
gtcaacgtgcactgnanttantgtntacttncggtaagncttcggctatcgacgggnacc
accttatgttatttcatcatgGCCCAGCGCTTAATTCGCGACGTCGACCGCGACTTGGGT
TCCACAACAACGAATCCCAGTGCGCACCGCACACCAGTCATGCTCATTTGGCGGTTTTTT
GGAATTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggg
tccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcca
tgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgcc
gagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgat
gtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactngctnnnnn
nnnnnggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE