| Strain Information | |
|---|---|
| DGRC Number | 112419 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP0961 / TM3, Ser[1] |
| Genotype | w*; P{w+mW.hs=GawB}NP0961 / TM3, Ser1 |
| Break points/Insertion Site | 85B7 |
| Map Viewer | ![]() |
| Related Genes | osk pyd |
| Original Number | 961 |
| Chromosome | 3 |
| Comments | Sb seems to be fixed. 27Nov2012 Y.Y. FlyBase Insertion: P{GawB}NP0961 NP line. Received from the National Institute of Genetics. |
| Balancer | CyO;TM3 Ser |
| Cluster id | 1396 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | pns (ch subset) |
| Larval X-gal | sg |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Sang Q, Wang G, Morton DB, Wu H, Xie B. The ZO-1 protein Polychaetoid as an upstream regulator of the Hippo pathway in Drosophila. PLoS Genet (2021) 17(11) e1009894 [PubMed ID = 34748546] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np09735_0727 |
| Strand | Minus |
| Insertion Point | 4757655 |
| Chromosome Band | 3R |
| Flanking Sequence | anngtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccacctt atgttatttcatcatgGCTGCTTCGCTCGAATTTGGTTCTCAGTCGGTTCAGATTATCGC GCTTGTGCGGTTGTGCGGAGCGGACGAGTTGAAATGGCCGAGTCGTGAACTTGAAATCTA TACAGGCGTTTTAAAACATAAACAAACAAATACGAATGCGAAAGAGCCGGTAAAAGTTTA AATGTTTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg gtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcc atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagctnnn nntnttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnn |