Detailed Information [112419]

Strain Information
DGRC Number 112419
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0961 / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP0961 / TM3, Ser1
Break points/Insertion Site 85B7
Map Viewer
Related Genes osk pyd
Original Number 961
Chromosome 3
Comments Sb seems to be fixed. 27Nov2012 Y.Y.
FlyBase Insertion: P{GawB}NP0961

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1396
General Information NP_lines
Embryonic Expression pns (ch subset)
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np09735_0727
Strand Minus
Insertion Point 4757655
Chromosome Band 3R
Flanking Sequence
anngtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccacctt
atgttatttcatcatgGCTGCTTCGCTCGAATTTGGTTCTCAGTCGGTTCAGATTATCGC
GCTTGTGCGGTTGTGCGGAGCGGACGAGTTGAAATGGCCGAGTCGTGAACTTGAAATCTA
TACAGGCGTTTTAAAACATAAACAAACAAATACGAATGCGAAAGAGCCGGTAAAAGTTTA
AATGTTTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg
gtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcc
atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc
cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga
tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagctnnn
nntnttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn


CLOSE