Detailed Information [112446]

Strain Information
DGRC Number 112446
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}sdk[NP1013] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}sdkNP1013 w* / FM7c
Break points/Insertion Site 1C2
Map Viewer
Related Genes CG13362 skpA sdk
Original Number 1013
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1013

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 18
General Information NP_lines
Embryonic Expression a small # of cells (SG)
Larval GFP pns, gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17075_0807
Strand Plus
Insertion Point 445483
Chromosome Band X
Flanking Sequence
nttcttgggtgcaaaagccctttttttgnatacttcggaaagccttcggctatcgacggg
accacnttatgttatttcatcatgGGCTGCACTTACGCCACTTTTTGATTTGCTGCTCCC
TTTTGTCCACTAATCAAGAGTAGGGTGGGCAAACTCGCATTCTTACACTGAATTCACAAT
AAACAACGGTAACTCACTGTTTTCTGTAAATANTTTGGAGTATGATTATTAGAAATTGAT
TTGTAATAGCTCCATATGCGGAATGTTGCTTCTAAAAACAAGTGAAACAACATGTAGTCA
GCGTGTGAATATTCTGAGCTTAGCTTTTTTTTCATATTTTTTTTTTNANATTTANCCANA
AGTNCCCTGNAAAAANGCCCTTNCCGAAGCTTNGGTTTNAAAATTNNGGTTCAGTTTTCC
ATAAANGCCCAAAANGCNTTGAATTNCCTTCCAAANAAGTNGAAAAAATTCTTTGGGTAN
CTAAATTTTTGGCTTTTTTTNTNGCCCTGAAAAAANTTTNTTTTTGGCNCTTATTTTTTT
CCNATTCNCATGCATTTTTTAAAAGATGTTCCANATAAACGATAATTGAGTTGAGCTGCA
CCGGCCCGTAANAAGAGAGCGATTTACAATAATTCTAATTTGGGGTTCANCTCCCGGGNT
ATGGGAACCCATGTNNACCATTATTNTTTAACGCATTTTNCCAAAAAGCATAANCCCCGG
GTTTGGCATCGNTCGAAAAAACCATAANAAAGAACCCGNNNCCAAANAACCCATTTTGGN
GGGGGCCCGTTTTNAGGAAGggcagcccctccccaatggtatccttttnaaaccaanaaa
tcctggnagagcctcccngggcaaaaaaccaccggattnggggggttttatgganagggg
gcggggnaatnnaanaagnaantggtt


CLOSE