Detailed Information [112451]

Strain Information
DGRC Number 112451
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}fs(1)h[NP1020] / FM7c
Genotype y* w* P{w+mW.hs=GawB}fs(1)hNP1020 / FM7c
Break points/Insertion Site 7D3
Map Viewer
Related Genes mys fs(1)h
Original Number 1020
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1020

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 212
General Information NP_lines
Embryonic Expression muscle (SG)
Larval GFP cns + pns
Larval X-gal sg, gc
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19545_0807
Strand Plus
Insertion Point 7800098
Chromosome Band X
Flanking Sequence
atnttttggggaaaaaaccctttttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTTCTGTGCGAGTGTGTGTGATAGAGAGAGCCAGAGAGC
AAAGTAGTCACACATACTCTCGCAAACTCATAGTGGCTTTCGTTCTCTCCTTTTCTCAAC
CATTTGCACGTACTTTTAGCTTTTTCATATGGTTNTTTGGGAAATTCACCAGCAGTTTAC
ACTTATGCTGNTGNTAGTTTTAATCCATTTATACTGGTAGAACGTAGATTCGTCGGCTAC
TTTACATTAATTTCGTAACGNAAGCGCAACAAAAACAANGNTGGCATCGATATAAGCANG
CGTTTTTGNCTGNAACTATCGGGCAATAAGNGACTNCCATAACCAGAGGTNCTTTACGNG
GNTCTCGAATACCTATCGGGTTGGGGTAGCGAGCCCAAAGTTNTTTTTTGNGGGGAAACA
AGCCTCCAAAAAGNGGAAACTGTTCCTAGGGTCGGGGGGGCCCCAGGTTTTTTAAACCCC
TGGGGAANATTGGGNGGGGAAATTTGNAANAANATTGGNTGTGGGTTCCCCCCCCGGGGG
CNCCCTTTGGGGNAACCTNGAAACACNCCCCNTTNGGAAAACCTTNAAAGAAACCCCCGC
CCNAAAAACCCCATTTTGTGGGGGGCCCCCTTTNNGGGGNGGGGGNCCCCCNCCCCCNNT
TNNTTTCTNTTTTNAAACAANAAANNNNTTNNGGGGNGGGCCCCCGGGGGAAAAAAAAAA
CCCAGGANNNNGGGGGGTNNtaaaaaaggggggggngggnnnaaaaaaaaaaaaaaaaaa
nanngnntnnnnccccntntnnaaccccctttnnncngggggggngggggnccccntttt
tttttnnnggnnnaaaaaaaggggg


CLOSE