Detailed Information [112482]

Strain Information
DGRC Number 112482
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1068 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1068 / FM7c
Break points/Insertion Site 11A1
Map Viewer
Related Genes fw CG1806 CG18130
Original Number 1068
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1068

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 299
General Information NP_lines
Embryonic Expression a small # of cells, hg (SG)
Larval GFP tr, epi
Larval X-gal epi, gut, sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Tachibana S, Touhara K, Ejima A.
Modification of Male Courtship Motivation by Olfactory Habituation via the GABAA Receptor in Drosophila melanogaster.
PLoS ONE (2015) 10(8) e0135186 [PubMed ID = 26252206] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17275_0807
Strand Minus
Insertion Point 11734635
Chromosome Band X
Flanking Sequence
annctttngggnaaaaaaccttttttngnatacttcggtaagccttcggctatcgacggg
accaccttatgttatttcatcatgGTGCAGACTGATACTTGATACAGCTTGGAGTGTGGT
TCGTTACAAACTTCTGTGGGACATTAAAACCAGTTATAAGCCAACTTTCATTCCAAGCAG
ACGTGCTGGGAGTTTCGCATCGGAAAGCGGNNNTTTTTTGTTTCGCCGTTGCAGTAGCAA
CAGCAACAGCAGCAGCGTTAACTCGTGCAAATGCAGCCAGGTCGCCCAAAACGAGAAATA
AGTTCACGTTCATAGGTATAGCCATTAATTTTTCCCATTTTCCTCGGCAATCCAATTCAG
CCGCAAACCCAAGCCGCGCTCTTTTCGCCTTTTTTTTTTCAANATTTNAANTTTAANTTT
AANTTTAANTTTTTCCCCGGGGGGGGGTACTGGTTTGGGGAAATTTTTGNTTTAGGGGGT
TTCAAAGGGGNCCTTTTCTTCCTTTTTTTTTTTTTTTTTGGGGGGNTTTNGGGGGGNAAC
CCGGNCAAAAAANAAANNNGGTTNTTTGNTTTAACCCCCCCCCCCCAAAAAAAAAGGGNA
AAACCCGNNNAATTTAAAAAANGGGGGGGAAANNAAAAGGGGNNCNNNNNANAAATTTAA
CCCCCCCGGGGGGGCCCNCCCCCCNCCTTTTTTTNGNCAAAAAAAAAAANGGGGNAGTTT
TTTTTNCNNGNAANCCNNNNGNGGGAACCCCCCCCCNAAAAACCCNCATTTTTNGGGGGG
GCCCCNTNNNANGGGGGGGGnnnccnccccnnnnnnttttttttttnnnncnnanaaann
cntnaaanaaannccnggggganaaaaaaaaacggnaantggggggantttaaaaaanag
gccnncccaac


CLOSE